BioTech FYI Center - Resources

EMBOSS FAQ (Frequently Asked Questions)

Part:   1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16 

(Continued from previous part...)

Q) What sequence formats are supported?
A) Many:

gcg, embl, swissprot, fasta, ncbi, genbank, nbrf, codata, strider, clustal, phylip, acedb, msf, ig, staden, text, raw, asis

Q) What is the difference between TEXT and RAW formats?
A) TEXT accepts everything in the sequence file as sequence. RAW accepts only alphanumeric and whitespace characters and rejects anything else.
Q) What is ASIS format?
A) The "filename" is really the sequence. This is a quick and easy way of reading in a short fragment of sequence without having to enter it into a file.

For example:

   % program -seq asis::ATGGTGAGGAGAGTTGTGATGAGA
Q) I have some very short protein sequences that EMBOSS thinks are nucleic sequences. How do I force EMBOSS to treat them as nucleic acid sequences?
For example:

   > cat seq1
   A
   > cat seq2
   I

   % water seq1 seq2 -stdout -auto
   Smith-Waterman local alignment.
   An error has been found: Sequence is not nucleic

Here, 'water' automatically (and wrongly) thinks that A is adenosine instead of alanine and fails when it reads in seq2 and expects to find another nucleic acid sequence - but 'I' is not a valid base and so it fails.

A) For many sequence formats there is no way to specify the sequence type in the file, so EMBOSS has to guess.

There is a flag that can force EMBOSS programs to treat sequences as nucleic or protein.

   'water -help -verbose'

shows the full list of sequence qualifiers.

If you follow the sequence USA with '-sprotein' EMBOSS will check that it is a valid protein sequence.

If you need to force a sequence to be DNA, the qualifier is '-snucleotide'

The qualifier must follow the sequence to apply to one sequence, or can go at the start of the command line to refer to all sequences, for example:

   'water -sprotein seq4 seq3 -stdout -auto'

You can also use '-sprotein1' anywhere on the command line to refer to the first sequence and '-sprotein2' to refer to the second sequence.

Of course, like all EMBOSS qualifiers, you can shorten them so long as they are still unique. In this case, '-sp' and '-sn' will work (or '-sp1' and '-sp2' if you need the numbers).

(Continued on next part...)

Part:   1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16 

EMBOSS FAQ (Frequently Asked Questions)