BioTech FYI Center

Biotechnology Glossary

Part:   A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z 

(Continued from previous part...)

C  Cytosine residue in either DNA or RNA.

CAAT box  (also CAT box)  A conserved sequence found within the promoter region of the protein-encoding genes of many eukaryotic organisms. It has the consensus sequence GGCCAATCT; it occurs around 75 bases prior to the transcription initiation site; and it is one of several sites for recognition and binding of regulatory proteins called transcription factors.

cabinet  See growth cabinet.

calf scours. A watery diarrhoea in calves.

callus  (L. callum, thick skin; pl: calluses or calli)  1. A protective tissue, consisting of parenchyma cells, that develops over a cut or damaged plant surface.

    2. Mass of unorganized, thin-walled parenchyma cells induced by hormone treatment.

    3. Actively dividing non-organized masses of undifferentiated and differentiated cells often developing from injury (wounding) or in tissue culture in the presence of growth regulators.

callus culture  A technique of tissue culture; it is usually on solidified medium and initiated by inoculation of small explants or sections from established organ or other cultures (the inocula). Callus culture is used as the basis for organogenic (shoot, root) cultures, cell cultures or proliferation of embryoids. Callus cultures can be indefinitely maintained through regular sub-culturing.

calorie (abbr: cal)  Equivalent to the amount of heat required to raise the temperature of 1 gram of water from 14.5°C to 15.5°C (»4.19 J). cf kilocalorie.

calyx  (Gr. kalyx, a husk, cup)  All the sepals of a flower considered collectively. The outermost whorl of flower parts.

cambial zone  Region in stems and roots consisting of the cambium and its recent derivatives.

cambium  (L. cambium, one of the alimentary body fluids supposed to nourish the body organs; pl: cambia). A layer, usually regarded as one or two cells thick, of persistently meristematic tissue between the xylem and phloem tissues, and which gives rise to secondary tissues, thus resulting in an increase in diameter. The two most important cambia are the vascular (fascicular) cambium and the cork cambium.

cancer  Uncontrolled growth of the cells of a tissue or an organ in a multicellular organism. cf oncogenesis.

candidate gene  A gene whose function suggests that it may be involved in the genetic variation observed for a particular trait, e.g., the gene for growth hormone is a candidate gene for body weight.

candidate-gene strategy  An experimental approach in which knowledge of the biochemistry and/or physiology of a trait is used to draw up a list of genes whose protein products could be involved in the trait.

canine  Pertaining to dogs.

canola  Any of several cultivars of oilseed rape (more fully: canola oil); the vegetable oil high in mono-unsaturated fatty acid obtained from these cultivars.

cap  The structure found on the 5´-end of eukaryotic mRNA, and consisting of an inverted, methylated guanosine residue. See G cap.

cap site  The site in a gene where translation is initiated, a.k.a. translation initiation site.

capacitation  The final stage in the maturation process of a spermatozoon, taking place inside the female genital tract as the sperm penetrates the ovum.

capsid  The protein coat of a virus. The capsid often determines the shape of the virus. See coat protein.

carbohydrate  An organic compound based on the general formula Cx (H2O)y, performing many vital roles in living organisms. The simplest carbohydrates are the sugars (saccharides), including glucose and sucrose. Polysaccharides are carbohydrates of much greater molecular weight and complexity; examples are starch, which serves as energy store in plant seeds and tubers; cellulose and lignin that form the cell walls and woody tissue of plants of plants; glycogen, etc.

carbowax  See polyethylene glycol.

carcinogen  A substance capable of inducing cancer in an organism.

carcinoma  A malignant tumour derived from epithelial tissue, which forms the skin and the outer cell layers of internal organs.

carotene  (L. carota, carrot)  A reddish-orange plastid pigment involved in light reactions in photosynthesis.

carotenoid  Red to yellow pigments responsible for the characteristic colour of many plant organs or fruits, such as tomatoes, carrots, etc. Oxidation products of carotene are called xanthophylls. Carotenoids serve as light-harvesting molecules in photosynthetic assemblies and also play a role in protecting prokaryotes from the deleterious effects of light.

carboxypeptidases  Two enzymes (A and B) found in pancreatic juice. Their role is to remove the C-terminal amino-acid from a peptide; the A form removes any amino acid; the B form removes only lysine or arginine. Used when sequencing peptides.

carpel  Female reproductive organ of flowering plants, consisting of stigma, style and ovary. In some plants, one or more carpels unite to form the pistil.

carrier  In genetics, typically an individual that has one recessive mutant allele for some defective condition that is "masked" by a dominant normal allele at the same locus, i.e., an individual that is heterozygous for a recessive harmful allele and a dominant normal allele; the phenotype is normal, but the individual passes the defective (recessive) allele to half of its offspring.

carrier DNA  DNA of undefined sequence content which is added to the transforming (plasmid) DNA used in physical DNA-transfer procedures. This additional DNA increases the efficiency of transformation in electroporation and chemically mediated DNA-delivery systems. The mechanism responsible for this effect is not known. See also binary vector; plasmid; chimeric gene.

carrier gas  The gas that carries the sample in gas chromatography.

carrier molecule  1. A molecule that plays a role in transporting electrons through the electron transport chain. Carrier molecules are usually proteins bound to non-protein groups and able to undergoing oxidation and reduction relatively easily, thus allowing electrons to flow.

    2. A lipid-soluble molecule that can bind to lipid-insoluble molecules and transport them across membranes. Carrier molecules have specific sites that interact with the molecules they transport. Efficiency of carrier molecules may be modified by modifying the interacting sites through genetic engineering.

casein  A group of proteins found in milk.

casein hydrolysate  Mixture of amino acids and peptides produced by enzymatic or acid hydrolysis of casein. cf organic complex; undefined.

CAT box  See CAAT box.

catabolic pathway  A pathway by which an organic molecule is degraded in order to release energy for growth and other cellular processes; degradative pathway.

catalysis  The process of changing the rate of a chemical reaction by use of a catalyst.

catabolism  The metabolic breakdown of large molecules in living organism, with accompanying release of energy.

catabolite repression  Glucose-mediated reduction in the rates of transcription of operons that encode enzymes involved in catabolic pathways (such as the lac operon).

catalyst  (Gr. katalyein, to dissolve)  A substance that promotes a chemical reaction by lowering the activation energy of a chemical reaction, without itself undergoing any permanent chemical change. The process is catalysis. cf catalytic antibody; catalytic RNA.

catalytic antibody (= abzyme)  An antibody selected for its ability to catalyse a chemical reaction by binding to and stabilizing the transition-state intermediate.

catalytic RNA (= ribozyme; gene shears)  A natural or synthetic RNA molecule that cuts an RNA substrate.

cation  A positively charged ion; opposite is anion.

caulogenesis  Stem organogenesis; induction of shoot development from callus.

CD molecules; cluster of differentiation molecules  Any group of antigens that is associated with a specific sub-population of T cells. There are designations for surface molecules on various cells of the immune system, e.g., CD4 is present on the surface of helper T cells.

cDNA; complementary DNA  The double-stranded DNA complement of an mRNA sequence; synthesized in vitro from a mature RNA template using reverse transcriptase (to create a single strand of DNA from the RNA template) and DNA polymerase (to create the double-stranded DNA). Preparation of cDNAs is often the first step in cloning DNA sequences of interest. Used as specific and sensitive probes in hybridization studies, because cDNAs usually do not include regulatory or other controlling sequences, and so they can be used to identify (probe) and isolate genes and their associated sequences from genomic DNA. See binary vector; carrier DNA.

cDNA clone  A double-stranded DNA molecule that is carried in a vector and was synthesized in vitro from an mRNA sequence by using reverse transcriptase and DNA polymerase.

cDNA cloning  A method of cloning the coding sequence of a gene, starting with its mRNA transcript. It is normally used to clone a DNA copy of a eukaryotic mRNA. The cDNA copy, being a copy of a mature messenger molecule, will not contain any intron sequences and may be readily expressed in any host organism if attached to a suitable promoter sequence within the cloning vector.

cDNA library  A collection of cDNA clones that were generated in vitro from the mRNA sequences isolated from an organism or a specific tissue or cell type or population of an organism. cf library .

CDR  (complementarity-determining regions)  These are regions of the variable (V) regions of light and heavy antibody chains that make contact with the antigen. The primary amino acid sequences of these regions are highly variable among antibodies of the same class.

cell  (L. cella, small room)  The smallest structural unit of living matter capable of functioning independently; a microscopic mass of protoplasm surrounded by a semi-permeable membrane, usually including one or more nuclei and various non-living products, capable - either alone or by interacting with other cells - of performing all the fundamental functions of life.

cell culture  The in vitro growth of cells derived from multi-cellular organisms. The cells are usually of one type.

cell cycle  Sequence of stages that a cell passes through between one division and the next. The cell cycle oscillates between mitosis and the interphase, which is divided into G, S, and G2. In the G phase there is a high rate of biosynthesis and growth; in the S phase there is the doubling of the DNA content as a consequence of chromosome replication; in the G2 phase the final preparations for cell division (cytokinesis) are made.

cell differentiation  Continuous loss of physiological and cytological characters of young cells, resulting in getting the characters of adult cells. The unspecialized cells become modified and specialized for the performance of specific functions. Differentiation results from the controlled activation and de-activation of genes.

cell division  Formation of two or more daughter cells from a single mother cell. The nucleus divides first, followed by the formation of a cell membrane between the daughter nuclei. Division of cytoplasm and nucleus into two or more parts by formation of a cell plate.

cell-free protein synthesis; cell-free system  See in vitro translation.

cell-free transcription  See in vitro transcription.

cell-free translation  See in vitro translation.

cell fusion  Formation of a single hybrid cell from two cells of different species, cultured in vitro. The cells fuse and coalesce, but their nuclei may remain separated. During subsequent cell division, a single spindle is formed so that each daughter cell has a single nucleus containing sets of chromosomes from each parental line. Subsequent divisions often result in the loss of chromosomes and therefore of genes. The cell fusion technique can be used to determine the control of specific genes and their assignment to chromosomes. cf cell hybridization.

cell generation time  The interval between the beginning of consecutive divisions of a cell. The time that it takes for a population of single-celled organisms to double its cell number. Successive generations of cells or organisms within a population are separated by a time interval called generation time. The cell regeneration time can be determined with the aid of time-lapse microcinematography.

cell hybridization  The fusion of two or more dissimilar cells leading to the formation of a somatic hybrid. cf cell fusion.

cell line  A cell lineage that can be maintained in culture. A cell line arises from a primary culture. It implies that cultures from it consist of several lineages of the cells originally present in the primary culture.

cell-mediated immune response  The activation of T cells of the immune system in response to the presence of a foreign antigen.

cell membrane  The membrane that separates the cell wall and the cytoplasm, and regulates the flow of material into and out of the cell. See plasmalemma.

cell number  The number of cells per unit volume of a culture.

cell plate  The precursor of the cell wall, formed as cytokinesis starts during cell division. The cell plate develops in the region of the equatorial plate and arises from membranes in the cytoplasm.

cell sap  Water and dissolved substances, sugar, amino acids, waste substances, etc., in the plant cell vacuole.

cell selection  The process of selecting cells within a group of genetically different cells. Select cells or cell lines are sub-cultured onto fresh medium for continued selection and often are exposed to an increased level of the selection agent. The final objective is to regenerate plants exhibiting the traits selected for at the cellular level.

cell strain  A strain of cells having specific properties or markers derived from a primary culture of a cell line by selection or cloning. The selected properties must persist during subsequent cultivation. a.k.a. single-cell line.

cell suspension  Cells in culture in moving or shaking liquid medium, often used to describe suspension cultures of single cells and cell aggregates. See suspension culture.

cellular immune response  See T-cell-mediated (cellular) immune response.

cellular oncogene (proto-oncogene). A normal mammalian or avian gene that when mutated or improperly expressed contributes to the development of cancer. See oncogene.

cellulase  Enzyme catalysing the breakdown of cellulose.

cellulose  (cell + ose, a suffix indicating a carbohydrate)  A complex carbohydrate composed of long, unbranched chains of beta-glucose ((1.4)-linked-b-d-glucose) molecules, which contribute to the structural framework of plant cell walls. It comprises 40% to 55% by weight of the plant cell wall.

cellulose nitrate  See nitrocellulose.

cellulosome  A multi-protein aggregate that is present in some cellulolytic micro-organisms and contains multiple copies of all the enzymes required to completely break down cellulose. This complex is often found on the outer surface of cellulolytic micro-organisms.

cell wall  A rigid external coat which surrounds plant cells. It is formed outside the plasmalemma and consists primarily of cellulose.

centiMorgan (cM)  One percent recombination between two loci. See map distance; crossing-over unit.

central dogma  The basic concept that, in nature, genetic information generally can flow only from DNA to RNA to protein. It is now known, however, that information contained in RNA molecules of certain viruses (called retroviruses) can also flow back to DNA.

central mother cell  A subsurface cell located in a plant apical meristem and characterized by a large vacuole.

centres of origin  The locations in the world where particular domesticated plants originated. These areas show the highest variation, and are rich in wild alleles.

centrifugation  Separating molecules by size or density using centrifugal forces generated by a spinning rotor. G-forces of several hundred thousand times gravity are generated in ultracentrifugation. See density gradient centrifugation.

centrifuge  A device in which solid or liquid particles of different densities are separated by rotating them in a tube in a horizontal circle. The denser particles tend to move along the length of the tube to a greater radius of rotation, displacing the lighter particles to the other end.

centriole  An organelle in many animal cells that appears to be involved in the formation of the spindle during mitosis. During cell division, the two centrioles move to opposite sides of the nucleus to form the ends of the spindle.

centromere  The portion of the chromosome to which the spindle fibres attach during mitotic and meiotic division. It appears as a constriction when chromosomes contract during cell division. After chromosomal duplication, which occurs at the beginning of every mitotic and meiotic division, the two resultant chromatids are joined at the centromere.

centrosome  A specialized region of a living cell, situated next to the nucleus, where micro-tubules are assembled and broken down during cell division. The centrosome of most animal cells contains a pair of centrioles. During metaphase the centrosome separates into two regions, each containing one of the centrioles.

cephem-type antibiotic  An antibiotic that shares the basic chemical structure of cephalosporin.

chain terminator  1. Codons which do not code for an amino acid. They signal ribosomes to terminate protein synthesis. The codons are UAA, UAG and UGA, and have been termed ochre, amber and opal, respectively. Also known as stop codons or termination codons. Often two of these codons are found together at the end of a coding sequence of RNA.

    2. In the Sanger method of DNA sequencing, di-deoxynucleoside triphosphates are added as chain terminators in the synthesis of a complementary DNA strand.

character  A distinctive feature of an organism.

characterization  1. Of AnGR: All activities associated with the description of AnGR aimed at better knowledge of these resources and their state. (Source: FAO, 1999)

    Characterization by a country of its AnGR will incorporate development of necessary descriptors for use; identification of the country's sovereign AnGR; baseline and advanced surveying of these populations, including their enumeration and visual description, their comparative genetic description in one or more production environments, their valuation, and ongoing monitoring of those AnGR at risk. (Source: FAO, 1999)

    2. Of PGR: Systematic recording of descriptors that are independent of environmental factors.

charcoal  The black porous residue of partly burnt wood, bones, etc; a form of carbon. When treated to purify it and increase its adsorptive power, it is called activated charcoal (q.v.) in which form it is added to nutrient medium in order to prevent or decrease the effect of browning.

chelate  Noun: Complex organic molecule that can combine with cations and does not ionize. Chelates can supply micronutrients to plants at slow, steady rates. Usually used to supply iron to plant cells.

chemically-defined medium  When all of the chemical components of a plant tissue culture medium are fully known and defined. cf undefined; organic complex.

chemical mutagen  A chemical or product capable of causing genetic mutation in living organisms exposed to it.

chemiluminescence  The emission of light from a chemical reaction.

chemostat  A continuous and open culture in which growth rate and cell density are maintained constant by a fixed rate of input of a growth-limiting nutrient. cf phytostat.

chemotaxis  Motion of a motile cell, organism or part towards or away from an increasing concentration of a particular substance.

chemotherapy  The treatment of disease, especially infections or cancer, by means of chemicals. In treating cancers, it involves administering chemicals toxic to malignant cells.

chiasma  (Gr. chiasma, two lines placed crosswise; pl. chiasmata)  A visible point of junction between two non-sister chromatids of homologous chromosomes during the first meiotic prophase. a.k.a. cross-over. In the diplotene stage of prophase I of meiosis, the four chromatids of a bivalent are associated in pairs, but in such a way that one part of two chromatids is exchanged.

chimera (or chimaera)  From chimera, a mythological creature with the head of a lion, the body of a goat and the tail of a serpent. An organism whose cells are not all derived from the same zygote.

    1. Animal. An individual exhibiting two or more genotypes in patches derived from two or more embryos. An individual derived from two embryos by experimental intervention.

    2. Plant. Part of a plant with a genetically different constitution as compared with other parts of the same plant. It may result from different zygotes that grow together, or from artificial fusion (grafting); it may either be periclinal chimera, in which one tissue lies over another as a glove fits a hand; mericlinal chimera, where the outer tissue does not completely cover the inner tissue; and sectoral chimera, in which the tissues lie side by side.

    3. A recombinant DNA molecule that contains sequences from different organisms.

chimeric DNA  A recombinant DNA molecule containing unrelated genes.

chimeric gene  A semi-synthetic gene, consisting of the coding sequence from one organism, fused to promoter and other sequences derived from a different gene. Most genes used in transformation are chimeric. See carrier DNA; binary vector; plasmid; transformation; vector.

chimeric protein  See fusion protein.

chimeric selectable marker gene  A gene that is constructed from parts of two or more different genes and allows the host cell to survive under conditions where it would otherwise die.

chip, DNA  See DNA chip.

chi-squared test  (c2 test)  A significance test used to statistically assess the goodness of fit of observed data to a prediction.

chitin  A nitrogenous polysaccharide occurring as skeletal material in many invertebrates and fungi.

chitinase  An enzyme which breaks down chitin.

chloramphenicol  An antibiotic that interferes with protein synthesis.

chlorenchyma  (Gr. chloros, green + enchyma, a suffix meaning tissue)  Tissue containing chloroplasts, including leaf mesophyll and other parenchyma cells.

chlorophyll  (Gr. chloros, green + phyllon, leaf)  One of the two pigments responsible for the green colour of most plants. It is essential in the absorption of light energy for photosynthesis.

chloroplast  (Gr. chloros, green + plastos, formed)  Specialized cytoplasmic organelle that contains chlorophyll. Lens-shaped and bounded by a double membrane, chloroplasts contain membranous structures (thylakoids) piled up into stacks, surrounded by a gel-like matrix (stroma). They are the site of solar energy transfer and important reactions of starch or sugar synthesis. Chloroplasts have their own DNA and are inherited cytoplasmically, independent of nuclear genes.

chloroplastid  See chloroplast.

chlorosis  (Gr. chloros, green + osis, diseased state)  Failure of chlorophyll development, and appearance of yellow colour in plants, because of a nutritional disturbance or because of an infection by a virus, bacteria or fungus.

chromatid  (chromosome + id, L. suffix meaning "daughters of") Each of the two daughter strands comprising a duplicated chromosome. The term remains in use while the two chromatids are still joined at the centromere. As soon as the centromere divides, setting the two chromatids adrift (during anaphase of mitosis; and during anaphase II of meiosis), they are called chromosomes.

chromatin  (Gr. chroma, colour)  Substance of which eukaryotic chromosomes are composed. It consists of primarily DNAm with some proteins (mainly histones), and small amounts of RNA. Originally named because of the readiness with which it stains with certain dyes (chromaticity).

chromatin fibres  A basic organizational unit of eukaryotic chromosomes, consisting of DNA and associated proteins assembled into strands of 30 nm average diameter.

chromatography  (Gr. chroma, colour + graphein, meaning to draw or write) 1. A method for separating and identifying the components of mixtures of molecules having similar chemical and physical properties.

    2. The term originally used by Mikhail Tswett (1906) to describe the separation of a mixture of leaf pigments on a calcium carbonate column.

chromocentre  Body produced by fusion of the heterochromatic regions of the chromosomes in the polytene tissues (e.g., the salivary glands) of certain Diptera.

chromogenic substrate  A compound or substance that contains a colour-forming group.

chromomeres Small bodies, described by J. Belling, that are identified by their characteristic size and linear arrangement along a chromosome.

chromonema (pl: chromonemata)  An optically single thread forming an axial structure within each chromosome.

chromoplast  Plastid containing pigments, such a chloroplast, or one in which carotenoids predominate.

chromosomal aberration  Any change in chromosome structure or number. Although it can be a mechanism for enhancing genetic diversity, such alterations are usually fatal or ill-adaptive, especially in animals.

chromosomal integration site  A chromosomal location where foreign DNA can be integrated, often without impairing any essential function in the host organism.

chromosomal polymorphism  The occurrence of one to several chromosomes in two or more alternative structural forms within a population; the structurally changed chromosomes are the result of chromosome mutations (i.e., any structural change involving the gain, loss or re-location of chromosome segments).

chromosome  (Gr. chroma, colour + soma, body)  1. A single DNA molecule, a tightly coiled strand of DNA, condensed into a compact structure in vivo by complexing with accessory histones or histone-like proteins.

    2. A group of nuclear bodies containing genes which are largely responsible for the differentiation and activity of a eukaryotic cell; one of the bodies into which the nucleus resolves itself at the beginning of mitosis and from which it is derived at the end of mitosis. Chromosomes contain most of the cell's DNA. Chromosomes exist in pairs in eukaryotes - one paternal (from the male parent) and one maternal (from the female parent). Each eukaryotic species has a characteristic number of chromosomes. Bacterial and viral cells contain only a single chromosome, consisting of a single or double strand of DNA or, in some viruses, RNA, without histones.

chromosome aberration  Abnormal structure or number of chromosomes; includes deficiency, duplication, inversion, translocation, aneuploidy, polyploidy, or any other change from the normal pattern.

chromosome banding  Staining of chromosomes in such a way that light and dark areas occur along the length of the chromosomes in repeatable patterns. Lateral comparisons identify pairs. Each chromosome can be identified by its banding pattern.

chromosome mutation  A change in the gross structure of a chromosome, usually causing severely deleterious effects in the organism. They are often due to an error in pairing during the crossing-over stage of meiosis. The main types of chromosome mutation are translocation, duplication, deletion and inversion.

chromosome jumping  A technique that allows two segments of duplex DNA that are separated by thousands of base pairs (about 200 kb) to be cloned together. After sub-cloning, each segment can be used as a probe to identify cloned DNA sequences that, at the chromosome level, are roughly 200 kb apart. See positional cloning.

chromosome theory of inheritance  The theory that chromosomes carry the genetic information and that their behaviour during meiosis provides the physical basis for segregation and independent assortment.

chromosome walking  A technique that identifies overlapping cloned DNA fragments that form one continuous segment of a chromosome. These fragments can be generated either by random shearing or by partial digestion with a four-base-pair cutter such as Sau3A. A series of colony hybridizations is then carried out, starting with some cloned fragment which has already been identified and which is known to be in the region encompassed by the overlapping clones. This identified fragment is used as a probe to pick out clones containing adjacent sequences. These are then used as probes themselves to identify clones carrying sequences adjacent to them and so on. At each round of hybridization one "walks" further along the chromosome from the initial fragment. See positional cloning.

chymosin  An enzyme that clots milk; it is used in the manufacture of cheese.

cilium  (pl: cilia; adj: ciliate)  Hairlike locomotor structure on certain cells; a locomotor structure on a ciliate protozoan.

circadian Of physiological activity, etc.: occurring or recurring about once a day. cf diurnal.

2mm circle  See 2mm plasmid.

circularization  A DNA fragment generated by digestion with a single restriction endonuclease will have complementary 5´ and 3´ extensions (sticky ends). If these ends are annealed and ligated, the DNA fragment will have been converted to a covalently-closed circle, or circularized.

cis configuration  See coupling.

cis heterozygote  A heterozygote that contains two mutations arranged in a cis configuration (e.g., a+ b+ / a b).

cis-acting sequence  A nucleotide sequence that only affects the expression of genes located on the same chromosome.

cistron  A DNA sequence that codes for a specific polypeptide; a gene. See DNA; gene.

claims  The section of a patent that states, in detail, the uses and possible applications of the invention described in the patent.

class switching  The process during which a plasma cell stops producing antibodies of one class and begins producing antibodies of another class.

cleave  To break phospho-diester bonds of double-stranded DNA, usually with a type II restriction endonuclease. a.k.a. to cut or digest.

clonal propagation  Asexual propagation of many new plants (ramets) from an individual (ortet); all have the same genotype.

clonal selection  The production of a population of plasma cells all producing the same antibody in response to the interaction between a B lymphocyte producing that specific antibody and the antigen bound by that antibody.

clone  (Gr. klon, a twig or slip)  1. A group of cells or organisms that are genetically identical as a result of asexual reproduction, breeding of completely inbred organisms, or forming genetically identical organisms by nuclear transplantation.

    2. Group of plants genetically identical in which all are derived from one selected individual by vegetative propagation, without the sexual process.

    3. A population of cells that all carry a cloning vehicle with the same insert DNA molecule.

    4. Verb: To clone. To insert a DNA segment into a vector or host chromosome. See cloning.

    5. In AnGR: A genetic replica of another organism obtained through a non-sexual (no fertilization) reproduction process.

    Cloning by nucleus transfer involves the transfer of a donor cell (from (cultured) cells of embryonic, foetal or adult origin) into the recipient cytoplasm of an enucleated oocyte or zygote, and the subsequent development of embryos and animals. (Based on: FAO, 1999)

clone bank  See gene bank.

cloned strain or line  A strain or line descended directly from a clone.

cloning  1. The mitotic division of a progenitor cell to give rise to a population of identical daughter cells or clones.

    2. Incorporation of a DNA molecule into a chromosomal site or a cloning vector.

    3. Animal cloning: the creation of a whole animal by mitotic divisions from a single diploid somatic cell , typically by the process of nuclear transfer (q.v.). Cloning by nuclear transfer from undifferentiated embryonic cells has been possible for many years, but its widespread application has been hampered by inability to culture embryonic cells from animals other than mice. In 1997, Ian Wilmut and colleagues from Edinburgh showed that it is possible to create a whole animal from a cell taken from differentiated adult tissue, thereby opening up the possibility of widespread animal cloning. See directional cloning; megabase cloning; molecular cloning; sub-cloning; Dolly.

cloning site  See insertion site.

cloning vector  A small, self-replicating DNA molecule - usually a plasmid or viral DNA chromosome - into which foreign DNA is inserted in the process of cloning genes or other DNA sequences of interest. It can carry inserted DNA and be perpetuated in a host cell. Also called a cloning vehicle, vector, or vehicle.. See vector.

cloning vehicle  See cloning vector.

closed continuous culture  A continuous culture in which inflow of fresh medium is balanced by outflow of corresponding volumes of spent medium. Cells are separated mechanically from outflowing medium and added back to the culture. cf open continuous culture; batch culture; continuous culture.

cluster of differentiation  See CD.

cM  See centiMorgan; map distance.

coat protein (= capsid). The coating protein that encloses the nucleic acid core of a virus.

coccus  (pl: cocci) A spherical bacterium. Cocci may occur singly, in pairs, in groups of four or more, and in cubical packets.

coconut milk  Liquid endosperm of the coconut, often used to supply organic nutrients to cultured cells and tissues. See addendum; organic complex; undefined.

cocoon  A protective coverage for eggs and/or larvae produced by many invertebrates, such as the silkworm moth.

co-culture  The joint culture of two or more types of cells, such as a plant cell and a micro-organism, or two types of plant cells. Used in various dual-culture systems or in nurse-culture, q.v.

coding  The specification of a peptide sequence, by the code contained in DNA molecules.

coding sequence  That portion of a gene which directly specifies the amino acid sequence of its protein product. Non-coding sequences of genes include control regions, such as promoters, operators and terminators, as well as the intron sequences of certain eukaryotic genes.

coding strand  The strand of duplex DNA which contains the same base sequence (after substituting U for T) found in the mRNA molecule resulting from transcription of that segment of DNA. a.k.a. sense strand. The mRNA molecule is transcribed from the other strand, known as the template or antisense strand.

    Coding strand 5´ ATGAAAGCTTTAGTGGGCGCCCGTAT 3´

    Template strand 3´ TACTTTCGAAATCACCCGCGGGCATA 5´

    mRNA 5´ AUGAAAGCUUUAGUGGGCGCCCGUAU 3´

co-dominance  The situation in which both alleles in a heterozygous individual are expressed, so that the phenotype of heterozygotes incorporates the phenotypic effect of each allele. For example, roan coat colour in cattle results from a mixture of red hairs and white hairs, caused by heterozygosity for the red allele and the white allele. Also, protein polymorphisms and microsatellites show co-dominance: heterozygotes have two bands, whereas homozygotes have only one band.

co-dominant alleles  Alleles that produce independent effects when in the heterozygous condition.

codon  A set of three nucleotides in mRNA, functioning as a unit of genetic coding by specifying a particular amino acid during the synthesis of polypeptides in a cell. A codon specifies a transfer RNA carrying a specific amino acid, which is incorporated into a polypeptide chain during protein synthesis. The specificity for translating genetic information from DNA into mRNA, then to protein, is provided by codon-anticodon pairing. See anticodon; initiation codon; termination codon.

codon optimization  An experimental strategy in which codons within a cloned gene - ones not generally used by the host cell translation system - are changed by in vitro mutagenesis to the preferred codons, without changing the amino acids of the synthesized protein.

coefficient  A number expressing the amount of some change or effect under certain conditions (e.g., the coefficient of inbreeding).

co-enzyme  An organic molecule of low molecular weight and usually non-protein, such as a vitamin, that binds to an enzyme and promotes its catalytic activity.

co-evolution  The evolution of complementary adaptations in two species caused by the selection pressure that each exerts on the other. It is common in symbiotic associations, in insect-pollinated plants, etc.

co-factor  An organic molecule or inorganic ion necessary for the normal catalytic activity of an enzyme.

co-fermentation  The simultaneous growth of two micro-organisms in one bioreaction.

co-generation  Production of both electricity and process heat (steam) in an industrial plant.

cohesion  Holding together; a force holding a solid to a solid or a solid to a liquid, owing to attraction between like molecules.

cohesive ends  Double-stranded DNA molecules with single-stranded ends which are complementary to each other, enabling the different molecules to join each other. a.k.a. protruding ends; sticky ends; overhang. cf cos ends. See extension.

coincidence  The ratio of the observed frequency of double crossings-over to the expected frequency, where the expected frequency is calculated by assuming that the two crossing-over events occur independently of each other.

co-integrate vector system  A two-plasmid system for transferring cloned genes to plant cells. The cloning vector has a T-DNA segment that contains cloned genes. After introduction into Agrobacterium tumiefasciens, the cloning vector DNA undergoes homologous recombination with a resident disarmed Ti plasmid to form a single plasmid carrying the genetic information for transferring the genetically engineered T-DNA region to plant cells.

co-integrate  A DNA molecule formed by the fusion of two different DNA molecules, usually mediated by a transposable element.

colchicine (L. colchicum, meadow saffron, from colchis, ancient Mingrelia). An alkaloid obtained from Colchicum autumnale, autumn crocus or meadow saffron, which inhibits spindle formation in cells during mitosis, so that chromosomes cannot separate during anaphase, thus inducing multiple sets of chromosomes. Also used to halt mitosis at metaphase - the stage when chromosomes are most visible.

coleoptile  Protective sheath covering the shoot apex of the embryo in monocotyledenous plants. It protects the plumule as it emerges through the soil.

coleorhiza  (Gr. koleos, sheath + rhiza, root)  A protective sheath surrounding the radicle of monocotyledenous plants.

co-linearity  A relationship in which the units in one molecule occur in the same sequence as the units in another molecule which they specify; e.g., the nucleotides in a gene are co-linear with the amino acids in the polypeptide encoded by that gene.

collection  In PGR: see base collection; active collection.

collenchyma  (Gr. kolla, glue + enchyma, a suffix, derived from parenchyma and denoting a type of cell tissue) A tissue of living cells, the walls being unevenly thickened with cellulose and hemicellulose, but never lignified; it functions in mechanical support in young, short-lived or non-woody organs and is thus found in midribs and leaf petioles.

colony hybridization  A technique that uses a nucleic acid probe to identify a bacterial colony with a vector carrying a specific cloned gene or genes.

colony  1. An aggregate of identical cells (clones) derived from a single progenitor cell.

    2. A group of interdependent cells or organisms.

combinatorial library  During the ligation reaction with cDNAs of light and heavy antibody chains into a bacteriophage lambda (1) vector, many novel combinations consisting of one heavy and one light chain coding region are formed. The library comprises these combinations, each in a separate vector.

commensalism  The interaction of two or more dissimilar organisms where the association is advantageous to one without affecting the other(s). cf parasitism; symbiosis.

companion cell  Living cell associated with the sieve cell of phloem tissue in vascular plants.

comparative gene mapping The comparison of map locations of genes between species. The results of these comparisons indicate substantial conservation of blocks of genes and even large segments of chromosomes between species. Great use can be made of this conservation of map position. For example, in the case of mammals, it means that if a gene has been mapped in one or both of the intensely-mapped species (humans and mice), then the likely location of that gene in other mammals can be predicted with considerable confidence. Conversely, if a mapped anonymous DNA marker has an effect on a quantitative trait (this being indicative of the marker being linked to a quantitative trait locus (QTL)) in, say, cattle, then knowledge of the comparative map between cattle and humans can identify genes in the homologous region of the human genome that could correspond to the QTL. Such genes are called comparative positional candidate genes (q.v.).

comparative positional candidate gene  A gene that is likely to be located in the same region as a DNA marker that has been shown to be linked to a single-locus trait or to a quantitative trait locus (QTL), where the gene's likely location in the genome of the species in question is based on its known location in the map of another species, i.e., is based on the comparative map between the two species.

competence  Ability of a bacterial cell to take up DNA molecules and become genetically transformed.

competency  An ephemeral state, induced by treatment with cold cations, during which bacterial cells are capable of taking up foreign DNA.

competent  A competent cell is capable of developing into a fully functional embryo. The opposite is non-competent.

complement proteins  Proteins that bind to antibody-antigen complexes and help degrade the complexes by proteolysis.

complementarity  The relationship between the two strands of a double helix of DNA. Thymine in one strand pairs with adenine in the other strand, and cytosine in one strand pairs with guanine in the other strand.

complementarity-determining regions  See CDR.

complementary DNA  See cDNA.

complementary entity  1. One of a pair of nucleotide bases that form hydrogen bonds with each other. Adenine (A) pairs with thymine (T) [or with Uracil (U) in RNA], and guanine (G) pairs with cytosine (C).

    2. One of a pair of segments or strands of nucleic acid that will hydridize (join by hydrogen bonding) with each other.

complementary genes  Two or more interdependent genes, such that (in the case of dominant complementarity) the dominant allele from either gene can only produce an effect on the phenotype of an organism if the dominant allele from the other gene is also present; or (in the case of recessive complementarity) only double homozygous recessive show the effect.

complementary homopolymeric tailing  The process of adding complementary nucleotide extensions to different DNA molecules, e.g., dG (deoxyguanosine) to the 3´-hydroxyl ends of one DNA molecule and dC (deoxycytidine) to the 3´-hydroxyl ends of another DNA molecule to facilitate, after mixing, the joining of the two DNA molecules by base pairing between the complementary extensions. Also called dG - dC tailing, dA - dT tailing.

complementary nucleotides  Members of the pairs adenine-thymine, adenine-uracil, and guanine-cytosine that have the ability to hydrogen bond to one another. See nucleotide.

complementation  See genetic complementation.

complementation test; trans test  Introduction of two mutant chromosomes into the same cell to determine whether the mutants are alleles of the same gene. If the mutations are non-allelic, the genotype will be m1 +/+ M2 , and the phenotype will be wild-type (normal), because each chromosome "covers" for the other. In contrast, if they are allelic, the mutant phenotype will result.

complete digest  The treatment of a DNA preparation with an endonuclease for sufficient time for all of the potential target sites within that DNA to have been cleaved. cf partial digest.

composite transposon  A transposable element formed when two identical or nearly identical transposons insert on either side of a non-transposable segment of DNA, such as the bacterial transposon Tn5.

compound chromosome  A chromosome formed by the union of two separate chromosomes, as in attached-X chromosomes or attached-X-Y chromosomes.

concatemer  A DNA segment made up of repeated sequences linked end to end.

concordance  Identity of matched pairs or groups for a given trait, such as sibs expressing the same trait.

conditional lethal mutation  A mutation that is lethal under one set of environmental conditions - the restrictive conditions - but is viable under another set of environmental conditions - the permissive conditions, e.g., temperature-sensitive mutations.

conditioning  1. The effects on phenotypic characters of external agents during critical developmental stages.

    2. The undefined interaction between tissues and culture medium resulting in the growth of single cells or small aggregates. Conditioning may be accomplished by immersing cells or callus contained within a porous material (such as dialysis tubing) into fresh medium for a period dependent on cell density and a volume related to the amount of fresh medium.

conidium  (pl: conidia)  An asexual spore produced by a specialized hypha in certain fungi.

conjugation  1. Union of sex cells (gametes) or unicellular organisms during fertilization.

    2. The unidirectional transfer of DNA (bacterial plasmid) from one bacterium cell to another and involving cell-to-cell contact. The plasmid usually encodes the majority of the functions necessary for its own transfer.

conjugative functions  Plasmid-based genes and their products that facilitate the transfer of a plasmid from one bacterium to another.

consanguinity  Related by descent from a common ancestor.

consensus sequence  The nucleotide sequence that is present in the majority of genetic signals or elements that perform a specific function.

conservation of farm animal genetic resources  In AnGR: Refers to all human activities, including strategies, plans, policies and actions, undertaken to ensure that the diversity of farm animal genetic resources is being maintained to contribute to food and agricultural production and productivity; now and in the future. (Source: FAO, 1999)

constant domains  Regions of antibody chains that have the same amino acid sequence in different members of a particular class of antibody molecules.

constitutive enzyme An enzyme that is synthesized continually regardless of growth conditions. cf inducible enzyme; repressible enzyme.

constitutive gene  A gene that is continually expressed in all cells of an organism.

constitutive promoter  An unregulated promoter that allows for continual transcription of its associated gene. See promoter.

constitutive synthesis  Continual production of RNA or protein by an organism.

constitutive  An organism is said to be constitutive for the production of an enzyme or other protein if that protein is always produced by the cells under all physiological conditions. See inducible.

contaminant  Bacterial, fungal or algal micro-organism accidentally introduced into a culture or culture medium. Contaminant may overgrow the plant cells and consequently inhibit their growth. Working under aseptic conditions with a rigorous exclusion of potential contaminants must be practised in plant tissue culture. See disinfectation; disinfestation.

contig  A set of overlapping clones that provide a physical map of a portion of a chromosome. cf contiguous map.

contiguous map; contig map  The alignment of sequence data from large, adjacent regions of the genome to produce a continuous nucleotide sequence across a chromosomal region. See mapping.

continuous culture  A suspension culture continuously supplied with nutrients by the inflow of fresh medium. The culture volume is normally constant. cf batch culture; closed continuous culture; continuous fermentation; open continuous culture.

continuous fermentation  A process in which cells or micro-organisms are maintained in culture in the exponential growth phase by the continuous addition of fresh medium that is exactly balanced by the removal of cell suspension from the bioreactor. cf continuous culture.

continuous variation  Variation not represented by distinct classes. Phenotypes grade into each other, and measurement data are required for analysis. Multiple genes are usually responsible for this type of variation. a.k.a. quantitative variation. cf discontinuous variation.

control  1. Noun: Unchanged (standard) protocol or treatment for comparison with the experimental treatment. The term is commonly used for untreated organisms.

    2. Verb: To direct or regulate cultures with addition of plant growth regulators.

controlled environment  The environment in which parameters, such as light, temperature, relative humidity and sometimes the partial gas pressure, are fully controlled.

controlling element  In eukaryotes, transposable elements which control the activity of standard genes. A controlling element may, in the simplest case, inhibit the activity of a gene through becoming integrated in, or close to, that gene. Occasionally, either in germinal or somatic tissue, it may be excised from this site, and due to excision the activity of the gene is more or less restored, while the element may become reintegrated elsewhere in the genome where it may affect the activity of another gene. For example, in maize, a controlling element such as Ac or Ds is capable of influencing the expression of a nearby gene. See transposable element.

conversion  The development of a somatic embryo into a plant. See regeneration; micropropagation; organogenesis.

coordinate repression  Correlated regulation of the structural genes in an operon by a molecule that interacts with the operator sequence.

co-polymers  Mixtures consisting of more than one monomer; for example, polymers of two kinds of organic bases, such as uracil and cytosine (poly-UC) have been combined for studies of the genetic code.

copy DNA  See cDNA.

copy number  The average number of molecules of a plasmid or gene per genome contained in a cell.

co-repressor  An effector molecule that forms a complex with a repressor and turns off the expression of a gene or set of genes.

corpus  The corpus is found below the tunica (q.v.) and is a part of the apical meristem. In the corpus, cells divide in all directions, giving them an increase in volume. See apical meristem.

correlation  A statistical association between variables.

cortex  Primary tissue of a stem or root, bounded externally by the epidermis and internally in the stem by the phloem and in the root by the pericycle.

cos ends  The 12-base, single-strand, complementary extensions of bacteriophage lambda (l) DNA. a.k.a. cos sites.

co-segregation  When two genetic conditions appear to be inherited together.

cosmid  A plasmid vector which contains the two cos (cohesive) ends of phage lambda (l) and one or more selectable markers such as an antibiotic resistance gene. Cosmids exploit certain properties of phage lambda (l) to enable large, 40-50 kb, DNA fragments to be cloned at high efficiency. Cosmids and cosmid recombinants replicate as plasmids.

cos sites  See cos ends.

cot curve  When duplex DNA is heated, it dissociates into single strands. When the temperature is lowered, complementary strands tend to anneal or re-nature. The extent of re-naturation depends on the product of DNA concentration in moles of nucleotides per litre, and time in seconds. A graph showing the proportion of re-natured DNA against cot is known as a cot curve. The cot at which half the DNA has re-natured is the half-cot, a parameter indicating the degree of complexity of the DNA.

co-transfection  In baculovirus expression systems, the procedure by which the baculovirus and the transfer vector are simultaneously introduced into insect cells in culture.

co-transformation In genetic engineering experiments, it is often necessary to transform with a plasmid for which there is no selectable phenotype and then screen for the presence of that plasmid within the host cell. Co-transformation is a technique in which host cells are incubated with two types of plasmid, one of which is selectable and the other not. Cells which have been transformed with the first plasmid are then selected. If transformation has been carried out at high DNA concentration, then it is probable that these cells will also have been transformed with the second (non-selectable) plasmid. The technique is frequently used in experiments with mammalian cells.

cotyledons  Leaflike structures at the first node of the seedling stem. In some dicotyledons, they contain stored food for the young plant not yet able to photosynthesize its own food. Often referred to as seed leaves.

coupling The phase state in which either two dominant or two recessive alleles of two different genes occur on the same chromosome. Also called cis configuration. cf repulsion.

covalent bond  A bond in which an electron pair is equally shared by protons in two adjacent atoms.

covalently closed circle (CCC)  A double-stranded DNA molecule with no free ends. The two strands are interlinked and will remain together even after denaturation. In its native form, a CCC will adopt a supercoiled configuration.

co-variance A measure of the statistical association between variables; the extent to which two variables vary together.

cpDNA  The DNA of plant plastids, including chloroplasts.

critical breed  In AnGR: A breed where the total number of breeding females is less than 100 or the total number of breeding males is less than or equal to five; or the overall population size is close to, but slightly above 100 and decreasing, and the percentage of pure-bred females is below 80%. (Source: FAO, 1999)

critical-maintained breed; endangered-maintained breed  In AnGR: Categories where critical or endangered breeds are being maintained by an active public conservation programme or within a commercial or research facility. (Source: FAO, 1999)

cross  In genetic studies, the mating of two individuals or populations. Also called mating.

cross-breeding  Mating between members of different populations (lines, breeds, races or species).

cross hybridization  The hydrogen bonding of a single-stranded DNA sequence that is partially but not entirely complementary to a single-stranded substrate. Often, this involves hybridizing a DNA probe for a specific DNA sequence to the homologous sequences of different species.

crossing over  A process in which homologous chromosomes exchange material through the breakage and reunion of two chromatids. A single crossover represents one reciprocal breakage and reunion event. A double crossover requires two simultaneous reciprocal breakage and reunion events. a.k.a. recombination; recombination event.

crossover  A recombinant chromosome.

crossing-over unit  A measure of distance between two loci on genetic maps that is based on the average number of crossing-over events that take place in the interval between those two loci during meiosis. A map interval that is one crossing-over unit in length (a centiMorgan) describes an interval between two loci such that one in every hundred gametes recovered from meiosis is recombinant in that interval, i.e., the allele at the first locus is maternal in origin, while the allele at the other locus in that same gamete is paternal in origin.

cross pollination  Fertilization of a plant from a plant with a different genetic makeup.

cross pollination efficiency  Efficiency of pollen from one plant reaching the stigma of another plant.

crown gall (A.S. gealla, gall)  A bulbous growth that occurs at the base of certain plants as result of infection, especially by Agrobacterium tumefaciens; a bacterial gene carried by the Ti plasmid is transferred by the bacteria into a higher plant cell, where it causes a tumour-like growth. a.k.a. crown gall tumour. See Agrobacterium; hairy root disease.

crown  The region at the base of the stem of cereals and forage species from which tillers or branches arise. In woody plants, the root-stem junction. In forestry, the top portions of the tree.

cryobiological preservation; cryopreservation; freeze preservation. The preservation of germplasm resources in a dormant state by cryogenic techniques, as currently applied to storage of plant seeds and pollen, micro-organisms, animal sperm, and tissue culture cell lines. See ex situ conservation; gene bank.

cryogenic  At very low temperature.

cryopreservation  See cryobiological preservation.

cryoprotectant  Compound preventing cell damage during freezing and thawing processes. Cryoprotectants are agents with high water solubility and low toxicity. Two types of cryoprotectant agent are commonly used: permeating (glycerol and DMSO (q.v.)) and non-permeating (sugars, dextran, ethylene glycol, polyvinyl pyrolidone and hydroxyethyl starch).

cryptic  1. Structurally heterozygous individuals not identifiable on the basis of abnormal meiotic-chromosome pairing configurations ('cryptic structural hybrids').

    2. A form of polymorphism controlled by recessive genes ('cryptic polymorphism').

    3. Any mutation which is exposed by a sensitizing mutation and otherwise poorly detected (such mutations probably escape detection because of the plasticity of composition of the corresponding polypeptide).

    4. Phenotypically very similar species (cryptic species) which do not hybridize under normal conditions.

    5. Cryptic genetic variation refers to the existence of, for example, alleles conferring high performance for a trait, in a breed that has low performance for that trait.

cultivar (from cultivated + variety) (abbr: cv.)  A category of plants that are, firstly, below the level of a sub-species taxonomically, and, secondly, found only in cultivation. It is an international term denoting certain cultivated plants that are clearly distinguishable from others by stated characteristics and that retain their distinguishing characters when reproduced under specific conditions.

culture  A population of plant or animal cells or micro-organisms that is grown under controlled conditions.

culture alteration  A term used to indicate a persistent change in the properties of a culture's behaviour (e.g., altered morphology, chromosome constitution, virus susceptibility, nutritional requirements, proliferative capacity, etc.). The term should always be qualified by a precise description of the change which has occurred in the culture.

culture medium  Any nutrient system for the cultivation of cells of plants, bacteria or other organisms; usually a complex mixture of organic and inorganic nutrients. cf medium.

culture room  Room for maintaining cultures and often in a controlled environment of light, temperature and humidity. cf growth cabinet; incubator.

curing  The elimination of a plasmid from its host cell. Many agents which interfere with DNA replication, e.g., ethidium bromide, can cure plasmids from either bacterial or eukaryotic cells.

cut  Slang: to make a double-stranded break in DNA, usually with a type II restriction endonuclease. E.g., "The DNA was cut with EcoRI and run out on a 1% agarose gel." cf nick; cleave.

cuticle  (L. cuticula, diminutive of cutis, the skin)  Layer of cutin or wax on the outer surface of leaves and fruits and that reduces water loss.

cutting  Noun: A detached plant part that under appropriate cultural conditions can regenerate the complete plant without a sexual process.

cybrid  A cytoplasmic hybrid, originating from the fusion of a cytoplast (the cytoplasm without nucleus) with a whole cell, as in nuclear transfer (although the term is not used in that context). Note that the nucleus and cytoplasm of the fused cell products are from different genetic sources.

cyclic AMP (cyclic adenosine monophosphate)  A "messenger" that regulates many intracellular reactions by transducing signals from extracellular growth factors to cellular metabolic pathways.

cyclodextrin  Cyclic polymer of dextrose.

cystein  An amino acid.

cytogenetics  Area of biology concerned with chromosomes and their implications in genetics, cellular activity and variability.

cytokine  In immunology, any of many soluble molecules that cells produce to control reactions between other cells.

cytokinesis  Cytoplasmic division and other changes exclusive of nuclear division that are a part of mitosis or meiosis. See cell division.

cytokinin  Plant growth regulators (hormones) characterized as substances that induce cell division and cell differentiation (e.g., BA, kinetin, and 2-iP). In tissue culture, these substances are associated with enhanced callus and shoot development. The compounds are derivatives of adenine.

cytology  The study of the structure and function of cells.

cytolysis  Cell disintegration.

cytoplasm  (Gr. kytos, a hollow vessel + plasma, form)  The living material of the cell, exclusive of the nucleus, consisting of a complex protein matrix or gel. The part of the cell in which essential membranes and cellular organelles (mitochondria, plastids, etc.) reside.

cytoplasmic genes  DNA-containing bodies in the cell but external to the nucleus.

cytoplasmic inheritance  Hereditary transmission dependent on the cytoplasm or structures in the cytoplasm rather than the nuclear genes; extrachromosomal inheritance. Thus, plastid characteristics in plants are inherited by a mechanism independent of nuclear genes.

cytoplasmic male sterility  Genetic defect due to defective functions of mitochondria in the pollen. Fertilization will not occur. Exploited in certain plant breeding strategies, such as F1-hybrid maize cultivars.

cytoplasmic organelles  Discrete sub-cellular structures located in the cytoplasm of cells; these allow division of labour within the cell.

cytosine  A pyrimidine base found in DNA and RNA.

cytosol  The fluid portion of the cytoplasm, i.e., the cytoplasm minus its organelles.

cytotoxic T cell  See killer T cell.

cytotype  A maternally inherited cellular condition in Drosophila that regulates the activity of transposable P elements.

(Continued on next part...)

Part:   A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z 

Biotechnology Glossary