What is ASIS format?

To see other biotech frequently asked questions, please visit http://biotech.fyicenter.com/faq/

(Continued from previous question...)

What is ASIS format?

A) The "filename" is really the sequence. This is a quick and easy way of reading in a short fragment of sequence without having to enter it into a file.

For example:

   % program -seq asis::ATGGTGAGGAGAGTTGTGATGAGA

(Continued on next question...)

Other Frequently Asked Questions

• Installing associated software MSE.
• How do i get the PNG driver?
• What is included in this FAQ collection?
• I am trying to write a web interface for an emboss program and run apache. The program complains that there is no HOME directory set.
• Can I get the latest code via CVS ?
• I am trying to compile PNG support into EMBOSS on our CTU Unix system. This requires the z, png and gd libraries, which are not on our system at the moment.
• What Graphics options are available?
• Where to look for the additional libraries needed for PNG.
• Is there a table of substitutes for GCG programs?
• Where's the documentation?
• More...