<< < 8 9 10 11 12 13   ∑:312  Sort:Date

editor.struct().bonds - Get Bond List
How to get a list of bonds currently in the Ketcher editor with the editor.struct().bonds property? If you want to get a list of bonds currently in the Ketcher editor, you can use the editor.struct().bonds property on the Ketcher Editor interface. Here is an HTML document that shows you how to get a...
2023-12-01, 1077🔥, 0💬

Motif ICM Logo with WebLogo Tools
How to Create Motif ICM Logo with WebLogo Tools? Motif ICM Logo is a graphical representation of the ICM (Information Content Matrix). Motif ICM Logo is also referred as Multiple Sequence Alignment Logo, Sequence Conservation Logo, or Sequence Logo. You can use the WebLogo tool provided by US Berkel...
2023-04-26, 1072🔥, 0💬

HOWTO Documents at BioPerl.org
What tutorials are provided at BioPerl.org? BioPerl.org provides the following tutorials in the format of HOWTO documents: Beginners HOWTO - Introduction to BioPerl for biologists. Features and Annotations HOWTO - Reading and writing detailed data associated with sequences. BlastPlus HOWTO - Create,...
2023-03-07, 1067🔥, 0💬

Double Stranded DNA, mRNA and Transcription
What are Double Stranded DNA and mRNA sequences? A Double Stranded DNA sequence actually contains two nucleotide strands. Here is a made-up example: DNA coding strand (aka Crick strand, strand +1) 5' ATGGCCATTGTAATGGGCCGCTGAAAGGGT GCCCGATAG3' DNA template strand (aka Watson strand, strand −1) which ...
2023-03-17, 1063🔥, 0💬

Sequence Score against PSSM with Bio.motifs
How to Calculate Sequence Score against PSSM with Bio.motifs? With the motif PSSM (Position-Specific Scoring Matrix) defined in the previous tutorial, we can define a matching score of any given sequence against the motif: score = sum_over_j(PSSM[S[j], j]) where: S[i] is a given sequence PSSM[i, j] ...
2023-06-19, 1057🔥, 0💬

Search NCBI Databases with Bio.Entrez.esearch()
How to Search NCBI Databases with Bio.Entrez.esearch() function? Bio.Entrez.esearch() function allows you to search NCBI Databases with a given criteria. It uses the Entrez Web services provided by www.ncbi.nlm.nih.gov. 1. Search in PubMed for publications that include Biopython in their title. It r...
2023-08-09, 1055🔥, 0💬

Show InChI String on Ketcher
How to display the InChI string of the molecule in Ketcher editor? You can follow steps below to display the InChI string of the molecule in Ketcher editor. 1. Open Ketcher editor as shown in previous tutorial. 2. Select the "Benzene" button in the template toolbar at the bottom of the editor window...
2023-10-27, 1049🔥, 0💬

Motif ICM with Bio.motifs
How to Calculate Motif ICM with Bio.motifs Module? ICM (Information Content Matrices) represents how important of each position over others. ICM can be expressed as: ICM[i,j] = PPM[i,j]*(IC t - U[j]) where: PPM[i,j] is the Position Probability Matrix IC t is the total IC: log 2 (n) n is the number o...
2023-05-31, 1041🔥, 0💬

Get Help Documentation with Biopython
How to Get Help Documentation with Biopython? Biopython has help documentations built in the library. You can use the help() to read them. Read help documentation on Biopython library. fyicenter$ python &gt;&gt;&gt; import Bio &gt;&gt;&gt; help(Bio) Help on package Bio: NAME ...
2023-07-29, 1035🔥, 0💬

Using Embedded 3Dmol Viewer
Where to find FAQ (Frequently Asked Questions) on Using Embedded 3Dmol Viewer? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team on Using Embedded 3Dmol Viewer. What Is Embedded 3Dmol Viewer Assign Embedded 3Dmol Viewer to DIV Multiple Selections wi...
2023-09-10, 1034🔥, 0💬

Global Query on All NCBI Databases with Bio.Entrez.egquery()
How to Global Query on All NCBI Databases with Bio.Entrez.egquery() function? Bio.Entrez.egquery() function allows you to perform a global search on all NCBI Databases for a given key word. It uses the Entrez Web services provided by www.ncbi.nlm.nih.gov. Here is an example on how to do a global sea...
2023-08-25, 1012🔥, 0💬

Molecule Structure with Directed Bonds
How to specify a directed bond at a stereocenter in a molecule structure in Ketcher file format? You need to use the optional "stereo" property to specify a directed bond at a stereocenter in a molecule structure. For example: "stereo": 1 - for a upward bond "stereo": 6 - for a downward bond Note th...
2024-03-07, 1009🔥, 0💬

Scaling Issue on Importing Ketcher File
Why is my reaction schema scaled badly when imported from the Ketcher editor UI? The Ketcher editor UI seems to have a code bug. When a reaction schema stored in a Ketcher file is imported from the editor user interface, atom locations and the reaction arrow may be scaled down or up when mapping to ...
2024-01-31, 987🔥, 0💬

Motif ICM as Relative Divergence with Bio.motifs
How to Calculate Motif ICM as Relative Divergence with Bio.motifs module? ICMRD (Information Content Matrices as Relative Divergence) represents how different a given PPM is from the uniform distribution. ICMRD can be expressed as: ICMRD[i,j] = PPM[i,j]*PSSM[i,j] where: PPM[i,j] is the Position Prob...
2023-05-31, 985🔥, 0💬

UI Components of Embedded 3Dmol Viewer
What functions are supported by UI components on the Embedded 3Dmol Viewer? UI components on the Embedded 3Dmol Viewer support the following functions: 1. Model Data Input: Accessible through the first icon on the left. You can load PDB protein data from the online PDB database, or molecule compound...
2023-09-10, 896🔥, 0💬

Assign Embedded 3Dmol Viewer to DIV
How to assign Embedded 3Dmol Viewer to a "div" element? Here is an HTML code example, Embedded-Viewer-PDB.html, that assigns the Embedded 3Dmol Viewer to in "div" element. It also uses "data-*" attributes to load a protein from the PDB Websites, creates a selection from chain A and displays it in ca...
2023-01-30, 842🔥, 0💬

"-o svg -xd -d" Bug in Open Babel 3.1.1
Why "obabel ... -o svg -xd -d" is not able to remove hydrogens? It seems to be code bug in the "obabel" command in Open Babel 3.1.1 release. In Open Babel 3.1.1 release, options -xd and -d are not respected together for SVG output in the "obabel -i sdf -o svg -xC -xt -xP400 -xd -d" command. For exam...
2023-01-24, 818🔥, 0💬

Multiple Selections with Embedded 3Dmol Viewer
How to create multiple selections apply different styles with Embedded 3Dmol Viewer? In order to create a separate selection, you need add a suffix code to the "data-select" attribute name as "data-select{code}". Then other selection related attributes can use the same suffix code to refer to the se...
2023-01-30, 811🔥, 0💬

$3Dmol.download('pdb:...', ...) - Download PDB Protein
How to download PDB Protein Data with the $3Dmol.download() method? The syntax to download PDB Protein Data with the $3Dmol.download() method is shown below: $3Dmol.download("pdb:{PDB_ID}" ,viewer, options, callback) -&gt; {$3Dmol.GLModel} viewer - The $3Dmol.GLViewer instance where the download...
2023-09-10, 806🔥, 0💬

Code Bug in server.py in 3Dmol Source Code
Why am I getting the "Connection refused" error when accessing my local 3Dmol Viewer? If you are getting the "Connection refused" error when accessing your hosted 3Dmol Viewer over the network, it's most likely caused by the code bug in the server's Python source code. 1. Make sure that your 3Dmol V...
2023-09-10, 734🔥, 0💬

Load Data from Another HTML Element
How to load molecule data from another HTML element into the Embedded 3Dmol Viewer? You can use "data-element" and "data-type" attributes on the DIV element to load molecule data another HTML element into the Embedded 3Dmol Viewer. Here is an HTML code example, Embedded-Viewer-data-element.h tml,tha...
2023-09-10, 712🔥, 0💬

Load Data by URL into Embedded 3Dmol Viewer
How to load data by URL into the Embedded 3Dmol Viewer? You can use "data-href" and "data-type" attributes on the DIV element to load molecule data from a URL into the Embedded 3Dmol Viewer. Here is an HTML code example, Embedded-Viewer-data-href.html ,that loads a Benzene molecule in SDF format wit...
2023-09-10, 708🔥, 0💬

Start Online 3Dmol Viewer on Linux
How to start Online 3Dmol Viewer on my local server? If you have installed the Online 3Dmol Viewer in your home directory as shown in the previous tutorial, you can start and test it with these steps: 1. Go to the Online 3Dmol Viewer directory: fyicenter$ cd 3Dmol.js/packages/learning-env ironment2....
2023-09-10, 699🔥, 0💬

Missing 3Dmol-min.js on Local 3Dmol Server
Why is my local 3Dmol server redirecting to browser to https://get.webgl.org/? If you access your local 3Dmol server with a browser, and you see the https://get.webgl.org/ Website displayed, it's most likely missing the 3Dmol-min.js file on the server. This may happen if 3Dmol server was not install...
2023-09-10, 659🔥, 0💬

<< < 8 9 10 11 12 13   ∑:312  Sort:Date