Collections:
What Are Translation Tables
What Are Translation Tables?
✍: FYIcenter.com
Translation tables, also called codon tables, are conversion tables that map 3-nucleobase combinations into amino acids to form protein sequences.
It is known that all organisms do not use exactly the same translation table. But they vary from a standard translation table slightly.
Biopython uses the standard translation table by default. You need to specify the table name, if you want to use a non-standard translation table.
The code below prints the standard translation table, which is indexed as table 1.
fyicenter$ python >>> from Bio.Data import CodonTable >>> standard_table = CodonTable.unambiguous_dna_by_id[1] >>> print(standard_table) Table 1 Standard, SGC0 | T | C | A | G | --+---------+---------+---------+---------+-- T | TTT F | TCT S | TAT Y | TGT C | T T | TTC F | TCC S | TAC Y | TGC C | C T | TTA L | TCA S | TAA Stop| TGA Stop| A T | TTG L(s)| TCG S | TAG Stop| TGG W | G --+---------+---------+---------+---------+-- C | CTT L | CCT P | CAT H | CGT R | T C | CTC L | CCC P | CAC H | CGC R | C C | CTA L | CCA P | CAA Q | CGA R | A C | CTG L(s)| CCG P | CAG Q | CGG R | G --+---------+---------+---------+---------+-- A | ATT I | ACT T | AAT N | AGT S | T A | ATC I | ACC T | AAC N | AGC S | C A | ATA I | ACA T | AAA K | AGA R | A A | ATG M(s)| ACG T | AAG K | AGG R | G --+---------+---------+---------+---------+-- G | GTT V | GCT A | GAT D | GGT G | T G | GTC V | GCC A | GAC D | GGC G | C G | GTA V | GCA A | GAA E | GGA G | A G | GTG V | GCG A | GAG E | GGG G | G --+---------+---------+---------+---------+--
The second table provided in Biopython is for Vertebrate Mitochondrial.
>>> mito_table = CodonTable.unambiguous_dna_by_id[2] >>> print(mito_table) Table 2 Vertebrate Mitochondrial, SGC1 | T | C | A | G | --+---------+---------+---------+---------+-- T | TTT F | TCT S | TAT Y | TGT C | T T | TTC F | TCC S | TAC Y | TGC C | C T | TTA L | TCA S | TAA Stop| TGA W | A T | TTG L | TCG S | TAG Stop| TGG W | G --+---------+---------+---------+---------+-- C | CTT L | CCT P | CAT H | CGT R | T C | CTC L | CCC P | CAC H | CGC R | C C | CTA L | CCA P | CAA Q | CGA R | A C | CTG L | CCG P | CAG Q | CGG R | G --+---------+---------+---------+---------+-- A | ATT I(s)| ACT T | AAT N | AGT S | T A | ATC I(s)| ACC T | AAC N | AGC S | C A | ATA M(s)| ACA T | AAA K | AGA Stop| A A | ATG M(s)| ACG T | AAG K | AGG Stop| G --+---------+---------+---------+---------+-- G | GTT V | GCT A | GAT D | GGT G | T G | GTC V | GCC A | GAC D | GGC G | C G | GTA V | GCA A | GAA E | GGA G | A G | GTG V(s)| GCG A | GAG E | GGG G | G --+---------+---------+---------+---------+--
Here is how to specify the table name with calling the translation() function.
fyicenter$ python >>> from Bio.Seq import Seq >>> messenger_rna = Seq("AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG") >>> messenger_rna Seq('AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG') >>> standard_protein = messenger_rna.translate(table=1) >>> standard_protein Seq('MAIVMGR*KGAR*') >>> mito_protein = coding_dna.translate(table="Vertebrate Mitochondrial") >>> mito_protein Seq('MAIVMGRWKGAR*')
⇒ Single Sequence Record in FASTA Format
⇐ mRNA, Protein and Translation
2023-03-17, 325🔥, 0💬
Popular Posts:
Molecule Summary: ID: FYI-1002508 Names: InChIKey: PYDWRLNPMMKKCI-UHFFFAOYS A-NSMILES: Fc4ccc(c2nc1s...
Molecule Summary: ID: FYI-1001336 SMILES: Fc1ccc(c(C(NOCC2CC2)=NC( =O)Cc2ccccc2)c1F)C(F)(F) FReceived...
How to use "-o ..." flag as a delimiter to separate output file from input files in a "babel" comman...
Molecule Summary: ID: FYI-1002221 Names: InChIKey: JKEJEOJPJVRHMQ-JTQLQIEIS A-NSMILES: CCCCCCCC(=O)N...
What is test testing area for? The testing area is provided to allow visitors to post testing commen...