Collections:
Double Stranded DNA, mRNA and Transcription
What are Double Stranded DNA and mRNA sequences?
✍: FYIcenter.com
A Double Stranded DNA sequence actually contains two nucleotide strands. Here is a made-up example:
DNA coding strand (aka Crick strand, strand +1) 5' ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3' DNA template strand (aka Watson strand, strand −1) which is the reverse complement of the coding strand 3' TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC 5'
The mRNA is derived from the biological transcription process, which does a reverse complement (TCAG → CUGA) from the DNA template strand.
Single stranded mRNA 5' AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG 3’
We can simulate this biological transcription process using the transcribe() function.
fyicenter$ python >>> from Bio.Seq import Seq >>> coding_dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG") >>> coding_dna Seq('ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG') >>> template_dna = coding_dna.reverse_complement() >>> template_dna Seq('CTATCGGGCACCCTTTCAGCGGCCCATTACAATGGCCAT') >>> messenger_rna = coding_dna.transcribe() >>> messenger_rna Seq('AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG')
We can also convert the mRNA (messenger_rna) back to the DNA coding strand, using the back_transcribe() function.
>>> coding_dna = messenger_rna.back_transcribe() >>> coding_dna Seq('ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG')
⇒ mRNA, Protein and Translation
⇐ Play with the Bio.Seq Module
2023-03-17, 261🔥, 0💬
Popular Posts:
Where to find FAQ (Frequently Asked Questions) on JSME JavaScript API? Here is a list of tutorials t...
Molecule Summary: ID: FYI-1002097 Names: InChIKey: FZERHIULMFGESH-UHFFFAOYS A-NSMILES: CC(=O)Nc1cccc...
Molecule Summary: ID: FYI-1002205 Names: InChIKey: SXWZQUCTTOBHJT-UHFFFAOYS A-NSMILES: CNC2Cc1ccccc1...
Molecule Summary: ID: FYI-1002508 Names: InChIKey: PYDWRLNPMMKKCI-UHFFFAOYS A-NSMILES: Fc4ccc(c2nc1s...
Molecule Summary: ID: FYI-1002042 Names: InChIKey: XRMBQHTWUBGQDN-UHFFFAOYS A-NSMILES: C=CC(=O)OCC(C...