< 1 2 3 >   ∑:57  Sort:Rank

Sequence Score against PSSM with Bio.motifs
How to Calculate Sequence Score against PSSM with Bio.motifs? With the motif PSSM (Position-Specific Scoring Matrix) defined in the previous tutorial, we can define a matching score of any given sequence against the motif: score = sum_over_j(PSSM[S[j], j]) where: S[i] is a given sequence PSSM[i, j] ...
2023-06-19, 1043🔥, 0💬

Motif ICM with Bio.motifs
How to Calculate Motif ICM with Bio.motifs Module? ICM (Information Content Matrices) represents how important of each position over others. ICM can be expressed as: ICM[i,j] = PPM[i,j]*(IC t - U[j]) where: PPM[i,j] is the Position Probability Matrix IC t is the total IC: log 2 (n) n is the number o...
2023-05-31, 1029🔥, 0💬

Motif ICM as Relative Divergence with Bio.motifs
How to Calculate Motif ICM as Relative Divergence with Bio.motifs module? ICMRD (Information Content Matrices as Relative Divergence) represents how different a given PPM is from the uniform distribution. ICMRD can be expressed as: ICMRD[i,j] = PPM[i,j]*PSSM[i,j] where: PPM[i,j] is the Position Prob...
2023-05-31, 982🔥, 0💬

Pairwise Sequence Alignment Score Settings
How to change Pairwise Sequence Alignment Score Settings? Bio.Align.PairwiseAligner().al ign()uses a set of Alignment Score Settings to control how each possible alignment score is calculated. It then returns only those alignments that have the highest score. Here are the Alignment Score Settings th...
2023-05-09, 1812🔥, 0💬

Calculate Pairwise Sequence Alignment
How to Calculate Pairwise Sequence Alignment? You can use the Bio.Align.PairwiseAligner() function to Calculate Pairwise Sequence Alignment. It uses the Needleman-Wunsch, Smith-Waterman, Gotoh (three-state), and Waterman-Smith-Beyer global and local pairwise alignment algorithms. Here is an example ...
2023-05-09, 1340🔥, 0💬

Fetch Sequences from NCBI with Bio.Blast.NCBIWWW.qblast()
How to Fetch Sequences from NCBI with Bio.Blast.NCBIWWW.qblast()? The function qblast() in the Bio.Blast.NCBIWWW module allows you to call the online version of BLAST to fetch DNA or protein sequences from https://blast.ncbi.nlm.nih.gov /Blast.cgi.Currently the qblast() function only works with 5 BL...
2023-05-09, 1308🔥, 0💬

Too Many Results from align() Function
Why there are So Many Results from the align() Function? If you are using the default score settings, you may get a very large number of possible alignments. Here is an example using the first and the third sequences from the PF05371_seed.faa file. fyicenter$ python &gt;&gt;&gt; from Bio...
2023-05-09, 1176🔥, 0💬

Parse PDB Entry with Bio.PDB.MMCIFParser.parser Module
How to Parse PDB Entry with Bio.PDB.MMCIFParser.parser.get _structure()function? Bio.PDB.MMCIFParser.parser.get _structure()function allows you to parse and any PDB (Protein Database) data files. 1. Download a PDB file in PDB format. fyicenter$ curl http://files.rcsb.org/view/1fa t.pdb&gt; 1fat....
2023-05-09, 1105🔥, 0💬

Use Bio.SearchIO Module to Parse BLAST XML Result
How to Use Bio.SearchIO Module to Parse BLAST XML Result? The Bio.SearchIO module allows to parse sequence search result from different result format. 1. Try the following code to query the "nt" database under the "blastn" program with a given DNA sequence, which is reverse translated from a protein...
2023-05-09, 1096🔥, 0💬

What Is BioJava
What is BioJava? BioJava is a open-source Java library for bioinformatics. BioJava versions and release dates are: BioJava 6.1.0 BioJava 6.0.0 BioJava 5.3.0 BioJava 5.2.0 BioJava 5.0.0 BioJava 4.2.9 BioJava 4.2.1 BioJava 4.2.0 BioJava legacy 1.9.1 Main modules of BioJava: The Core Module (biojava-co...
2023-04-26, 1308🔥, 0💬

BioJava - Java Bioinformatics Toolkit
Where to find FAQ (Frequently Asked Questions) on BioJava - Java toolkit for computational molecular biology? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team on BioJava - Java toolkit for computational molecular biology. What Is BioJava BioJava Li...
2023-04-26, 1121🔥, 0💬

Motif ICM Logo with WebLogo Tools
How to Create Motif ICM Logo with WebLogo Tools? Motif ICM Logo is a graphical representation of the ICM (Information Content Matrix). Motif ICM Logo is also referred as Multiple Sequence Alignment Logo, Sequence Conservation Logo, or Sequence Logo. You can use the WebLogo tool provided by US Berkel...
2023-04-26, 1066🔥, 0💬

BioJava Library Installation Options
What are installation options for BioJava Library? There are several ways to install BioJava Library. 1. Using "Maven" build tool - Add BioJava as a dependency to your project pom.xml file: &lt;dependencies&gt; &lt;dependency&gt; &lt;groupId&gt;org.bio java&lt;/groupId&...
2023-04-25, 1302🔥, 0💬

Use BioJava with "Maven" Build Tool
How to Use BioJava with "Maven" Build Tool? If you want to install one or more BioJava Libraries with Maven, you can include BioJava libraries as dependencies in the Maven project file as shown in this tutorial. 1. Make sure that you have JDK installed. fyicenter$ javac -version javac 17.0.1 2. Make...
2023-04-25, 1163🔥, 0💬

"mvn dependency:build-classpath" - Generate Class Pass
How to generate class path for dependences with Maven? If you run your application JAR file generated from Maven, you need to include JAR files of all dependences in the class path. One way to build this class path is to use the "mvn dependency:build-classpath" command. 1. Generate class path of all...
2023-04-17, 2795🔥, 0💬

Read FASTA File with FastaReaderTeat.java
How to read a FASTA fie with FastaReaderTeat.java? If you compiled the example program, FastaReaderTeat.java, with Maven as shown in the previous tutorial, you can follow these steps to read a FASTA file. 1. Prepare a FASTA file, example.fasta. fyicenter$ cd bio fyicenter$ vi example.fasta &gt;s...
2023-04-17, 1129🔥, 0💬

BioPerl - Perl Bioinformatics Toolkit
Where to find FAQ (Frequently Asked Questions) on BioPerl - Perl toolkit for computational molecular biology? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team on BioPerl - Perl toolkit for computational molecular biology. What Is BioPerl BioPerl Mo...
2023-04-17, 1072🔥, 0💬

What Is BioPerl
What is BioPerl? BioPerl is a toolkit of perl modules useful in building bioinformatics solutions in Perl. It is built in an object-oriented manner so that many modules depend on each other to achieve a task. The collection of modules in the bioperl-live repository consist of the core of the functio...
2023-04-05, 1376🔥, 0💬

Single Sequence Record in GenBank Format
How to read a Single Sequence Record in GenBank Format? The GenBank format for DNA or protein sequences contains more properties and a better structure that FASTA format. You can follow these steps to download GenBank file example and create a Bio.SeqRecord object. 1. Download an example of a Sequen...
2023-04-04, 1198🔥, 0💬

Single Sequence Record in FASTA Format
How to read a Single Sequence Record in FASTA Format? If you want to store additional information to a DNA or protein sequence, you can use the Bio.SeqRecord class, which contains the following properties: seq – The sequence itself as a Seq object. id – The primary ID used to identify the sequence. ...
2023-04-04, 1190🔥, 0💬

What Are Translation Tables
What Are Translation Tables? Translation tables, also called codon tables, are conversion tables that map 3-nucleobase combinations into amino acids to form protein sequences. It is known that all organisms do not use exactly the same translation table. But they vary from a standard translation tabl...
2023-03-17, 1266🔥, 0💬

mRNA, Protein and Translation
How to derive protein sequence from a mRNA sequence? Biologically, the protein sequence is produced by a translation process from a mRNA sequence. We can simulate this biological translation process using the translation() function. fyicenter$ python &gt;&gt;&gt; from Bio.Seq import Seq ...
2023-03-17, 1255🔥, 0💬

Double Stranded DNA, mRNA and Transcription
What are Double Stranded DNA and mRNA sequences? A Double Stranded DNA sequence actually contains two nucleotide strands. Here is a made-up example: DNA coding strand (aka Crick strand, strand +1) 5' ATGGCCATTGTAATGGGCCGCTGAAAGGGT GCCCGATAG3' DNA template strand (aka Watson strand, strand −1) which ...
2023-03-17, 1051🔥, 0💬

BioPerl Modules Installation Options
What are installation options for BioPerl modules? There are several ways to install one or more BioPerl modules. 1. Using "cpanm" command - Run "cpanm ..." to install the given module automatically from cpan.org repository, if have "cpanm" installed. For example, run "cpanm Bio::SeqIO" to install B...
2023-03-07, 1361🔥, 0💬

< 1 2 3 >   ∑:57  Sort:Rank