Atom Biology General Molecule Reaction Tools Trial Virus

<< < … 7 8 9 10 11 12 13 >   ∑:309  Sort:Date

UI Components of Online 3Dmol Viewer
What functions are supported by UI components on the Online 3Dmol Viewer? UI components on the Online 3Dmol Viewer support the following functions: 1. Model Data Input: Accessible through the "File/PDB/URL" menu item. You can load PDB protein data from the online PDB database, molecule compound data... 2023-09-07, 276🔥, 0💬

editor.struct() - Get Entire Structure
How to get the entire structure currently in the Ketcher editor with the editor.struct() method? If you want to get detailed information about the entire structure currently in the Ketcher editor, you can call the editor.struct() method on the Ketcher Editor interface. Here is an HTML document that ... 2023-12-08, 274🔥, 0💬

Double Stranded DNA, mRNA and Transcription
What are Double Stranded DNA and mRNA sequences? A Double Stranded DNA sequence actually contains two nucleotide strands. Here is a made-up example: DNA coding strand (aka Crick strand, strand +1) 5' ATGGCCATTGTAATGGGCCGCTGAAAGGGT GCCCGATAG3' DNA template strand (aka Watson strand, strand −1) which ... 2023-03-17, 273🔥, 0💬

"select=resi:..." - Select Protein Residues by Numbers
How to select Protein Residues by Numbers using the "select=resi:..." URL parameter in the Online 3Dmol Viewer? There are different ways to select Protein Residues by Numbers: select=resi:{number} - Select single residues. select=resi:{number-number} - Select multiple residues in a range. select=res... 2023-09-07, 272🔥, 0💬

Ketcher Editor Interface
Where to find FAQ (Frequently Asked Questions) on Ketcher Editor Interface? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team on Ketcher Editor Interface. What Is Ketcher Editor Interface editor.struct() - Get Entire Structure editor.struct().atoms ... 2024-01-10, 270🔥, 0💬

editor.struct().loops - Get Loop List
How to get a list of loops currently in the Ketcher editor with the editor.struct().loops property? If you want to get a list of loops currently in the Ketcher editor, you can use the editor.struct().loops property on the Ketcher Editor interface. Here is an HTML document that shows you how to get a... 2023-11-23, 270🔥, 0💬

Ketcher User Interface Menu Icons
What are Ketcher user interface menu icons? Ketcher user interface menu icons are organized into 4 toolbars: 1. Action toolbar - Displayed horizontally at the top of the window, the main toolbar contains the following buttons to perform different actions: Clear canvas - Removes everything in the edi... 2023-11-06, 269🔥, 0💬

Assign Embedded 3Dmol Viewer to DIV
How to assign Embedded 3Dmol Viewer to a "div" element? Here is an HTML code example, Embedded-Viewer-PDB.html, that assigns the Embedded 3Dmol Viewer to in "div" element. It also uses "data-*" attributes to load a protein from the PDB Websites, creates a selection from chain A and displays it in ca... 2023-02-04, 268🔥, 0💬

Show InChI String on Ketcher
How to display the InChI string of the molecule in Ketcher editor? You can follow steps below to display the InChI string of the molecule in Ketcher editor. 1. Open Ketcher editor as shown in previous tutorial. 2. Select the "Benzene" button in the template toolbar at the bottom of the editor window... 2023-10-27, 264🔥, 0💬

addSphere() - Create Spheres
How to create spheres with 3Dmol.js addSphere() methods? viewer.addSphere() method in the $3Dmol.GLViewer class allows you to create sphere objects. Here is the signature of the addSphere() method: {$3Dmol.GLViewer} addSphere({SphereStyleSpec} spec) -&gt; {$3Dmol.GLShape} Here is an HTML code ex... 2023-09-07, 264🔥, 0💬

"-o svg -xd -d" Bug in Open Babel 3.1.1
Why "obabel ... -o svg -xd -d" is not able to remove hydrogens? It seems to be code bug in the "obabel" command in Open Babel 3.1.1 release. In Open Babel 3.1.1 release, options -xd and -d are not respected together for SVG output in the "obabel -i sdf -o svg -xC -xt -xP400 -xd -d" command. For exam... 2023-01-24, 263🔥, 0💬

Multiple Selections with Embedded 3Dmol Viewer
How to create multiple selections apply different styles with Embedded 3Dmol Viewer? In order to create a separate selection, you need add a suffix code to the "data-select" attribute name as "data-select{code}". Then other selection related attributes can use the same suffix code to refer to the se... 2023-01-30, 262🔥, 0💬

Ketcher Indigo Interface
Where to find FAQ (Frequently Asked Questions) on Ketcher Indigo Interface? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team on Ketcher Indigo Interface. What Is Ketcher Indigo Interface indigo.calculate() - Calculates Chemical Properties indigo.ge... 2023-11-13, 261🔥, 0💬

addModel() - Add Model from Data
How to create a model from a molecule data string with 3Dmol.js addModel() methods? viewer.addModel() method in the $3Dmol.GLViewer class allows you to create a model from molecule data string: {$3Dmol.GLViewer} addModel(data, format, options) -&gt; {$3Dmol.GLModel} Here is an HTML code example,... 2022-12-26, 254🔥, 0💬

Call getSmiles() and getSmarts() Parallelly
Why do getSmiles() and getSmarts() methods return the same result, if they are called in 2 parallel promises? There seems to be a bug in Ketcher v2.11.0 release. If you call getSmiles() and getSmarts() methods one after the other, you are creating 2 promises The first promise seems to be overriding ... 2024-01-24, 251🔥, 0💬

editor.struct().atoms - Get Atom List
How to get a list of atoms currently in the Ketcher editor with the editor.struct().atoms property? If you want to get a list of atoms currently in the Ketcher editor, you can use the editor.struct().atoms property on the Ketcher Editor interface. Here is an HTML document that shows you how to get a... 2023-12-01, 250🔥, 0💬

editor.structSelected() - Get Selected Sub-Structure
How to get the selected sub-structure currently in the Ketcher editor with the editor.structSelected() method? If you want to get detailed information about the selected sub-structure currently in the Ketcher editor, you can use the editor.structSelected() method on the Ketcher Editor interface. Her... 2023-11-23, 244🔥, 0💬

editor.struct().bonds - Get Bond List
How to get a list of bonds currently in the Ketcher editor with the editor.struct().bonds property? If you want to get a list of bonds currently in the Ketcher editor, you can use the editor.struct().bonds property on the Ketcher Editor interface. Here is an HTML document that shows you how to get a... 2023-12-01, 241🔥, 0💬

Call getSmiles() and getSmarts() Chained
How to call getSmiles() and getSmarts() methods in 2 promises one chained to the other? Another way to avoid the bug mentioned in the previous tutorial is to call ketcher.getSmiles() and ketcher.getSmarts() methods in 2 chained promises. Chained promises use fulfilled and rejected handlers of the pr... 2024-01-15, 239🔥, 0💬

Ketcher Editor User Interface
Where to find FAQ (Frequently Asked Questions) on Ketcher Chemical Structure Editor User Interface? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team on Ketcher Chemical Structure Editor User Interface. Ketcher User Interface Menu Icons Show InChI S... 2023-11-06, 238🔥, 0💬

Ketcher File Format for Chemical Structures
Where to find FAQ (Frequently Asked Questions) on Ketcher File Format for Chemical Structures? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team on Ketcher File Format for Chemical Structures. What Is Ketcher File Format Ketcher File Structure Expor... 2024-02-11, 235🔥, 0💬

GLViewer Class and Instance Methods
What is the GLViewer Class? GLViewer, or $3Dmol.GLViewer, is a class in the $3Dmol namespace, that defines a WebGL-based viewer. There are 2 ways to instantiate a GLViewer instance: new $3Dmol.GLViewer(element, config) -&gt; $3Dmol.GLViewer $3Dmol.createViewer(element, config) -&gt; $3Dmol.G... 2023-09-10, 235🔥, 0💬

Ketcher File Structure for Reaction
What is the Ketcher file structure for a chemical reaction? The Ketcher file structure for a chemical reaction is an extension of the Ketcher file structure for a molecule. Additional molecule objects are added as reactants, reagents, solvents, and products of the reaction. A long arrow is also adde... 2024-02-18, 226🔥, 0💬

Load Data by URL into Embedded 3Dmol Viewer
How to load data by URL into the Embedded 3Dmol Viewer? You can use "data-href" and "data-type" attributes on the DIV element to load molecule data from a URL into the Embedded 3Dmol Viewer. Here is an HTML code example, Embedded-Viewer-data-href.html ,that loads a Benzene molecule in SDF format wit... 2023-09-10, 224🔥, 0💬

<< < … 7 8 9 10 11 12 13 >   ∑:309  Sort:Date

Atom Biology General Molecule Reaction Tools Trial Virus